ARPHA Conference Abstracts : Conference Abstract
Print
Conference Abstract
Development of a set of oligonucleotides for the identification of the Sakhalin sturgeon Acipenser mikadoi Hilgendorf, 1892 by PCR
expand article info Sergei Turanov ‡, §
‡ A.V. Zhirmunsky National Scientific Center of Marine Biology, Vladivostok, Russia
§ Far Eastern State Technical Fisheries University, Vladivostok, Russia
Open Access

Abstract

Sturgeons (family Acipenseridae) are valuable commercial fish and aquaculture resources. The Acipenser genus includes about 20 species, 12 of which are recorded for the Russian territory. One of the rarest is the Sakhalin sturgeon A. mikadoi Hilgendorf, 1892. At present, its population size is significantly decreased and the species is close to extinction. Natural populations of the species have survived in the Tumnin River in Khabarovsk Region and the Viakhtu River in Sakhalin Region. Vihtu River in Sakhalin Region. Due to the small numbers of rare and endangered fish species, noninvasive approaches, including the use of DNA from the environment, appear to be the most suitable for monitoring their species and genetic diversity. The method is well established in this area and has been successfully tested for the monitoring of several species of rare and endangered sturgeons. This paper presents the results of the development of primers specific for the mitochondrial DNA of the species A. mikadoi.

A matrix of 15 sequences of complete mitochondrial genomes from 3 sturgeon species whose ranges may overlap - A. mikadoi (KX276658), A. dauricus (KJ402277) and A. schrenckii (MH973728- MH973734, KX276660, KX276659, KF150287, KC905169, KC820796) - was generated. A. medirostris (NC_028405), which is genetically closest to the Sakhalin sturgeon, was also included in the analysis. A sliding window algorithm was applied to the sequence matrix. A graph showing the distribution of divergence values along the mitochondrial genome of sturgeon was plotted based on the results of the analysis Fig. 1.

Figure 1.  

Figure 1: Distribution of divergence values (p-distance) along 15 mitochondrial genome sequences of 4 sturgeon species. The analysis was performed using a sliding window algorithm. Vertical dashed lines indicate fragment boundaries, which were used to design species-specific primers.

Based on matrices of individual genome fragments (16S rRNA, COI, ND1, and D-loop), a search for species-specific primers was performed in the DECIPHER program. A Primer-BLAST algorithm was run based on each pair of primers. Taxa Actinopterygii and Acipenseridae were used as references separately in different runs. In addition, primers were checked using local reference sequences of the complete mitochondrial genome of representatives of the genus Acipenser. The results of primer evaluation are summarized in the table Table 1. As a result, a combination of primer pairs developed on the basis of D-loop and COI fragments seems to be the most successful for error-free identification of Sakhalin sturgeon.

Table 1.

Table 1: Information on pairs of the most appropriate species-specific primers selected by DECIPHER based on several regions of the sturgeon mitochondrial genome. Lamp - length of the amplified fragment, bp; Tm - melting temperature of forward and reverse primers, °C; Spn - species detected by Primer-BLAST searches among taxa of the family Acipenseridae (excluding A. mikadoi); Spc - number of homologous sequences detected by Primer-BLAST searches among taxa of the class Acipenseridae (excluding A. mikadoi)

Name of the pair of primers

Forward and reverse primer sequences, 5`-3` direction

Lamp

Tm

Spn

Spc

D-loop_114

CACTAACATGCGATTTCCCGATACT / CAGTTGTGAATCCCTACAGTTGTT

114

56.9 / 55.2

A. medirostris

0

COI_219

ACTCGTCCCTAGATATTGTGCTT / GGCCTAGGAAATGTTGGGGAAAA

219

55.4 / 57.6

A. medirostris

379

D-loop_I

AAGGCCTGTCTAGAACATTAGGTT / CCATTCACTATTCATTCCTCTGGGAG

308

59.46 / 60.97

0

Keywords

Sakhalin sturgeon, Acipenser mikadoi, primer desig

Presenting author

Sergei Turanov

Presented at

1st DNAQUA International Conference (March 9-11, 2021)

Grant title

Grant of the President of the Russian Federation (MK-305.2019.4) and Ministry of Science and Higher Education of the Russian Federation (agreement number 075-15-2020-796, grant number 13.1902.21.0012)